AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |
Back to Blog
Pvc pipe bird feeder stand red12/8/2023 To protect it from squirrels, you can experiment some tricks yourself. Secure the birdfeeder to the PVC pipe by tightening nuts on the bolts. This bird feeder might not be squirrel resistant, but it can be a great vintage addition to your yard. Attach the bird feeder to the PVC pipe by drilling holes in the back of the birdfeeder that match the holes on the PVC pipe, and sliding 2-inch bolts through the PVC pipe and into the back of the birdfeeder. Solve this problem by following some of the tips and tricks available here. Squirrels can be annoying especially if they steal away all the food from the bird feeders you put in your yard to enjoy bird watching. That’s all you need to do to complete this bird feeder DIY. LADDER PLAY GYM for cockatiels, lovebirds, conures, budgies, parakeets, and more Pvc pipe with vet wrap for grip, 3 tiered tabletop stand. Weatherable Bird tower, bird house and feeders, PVC low maintenance, stand alone feeder, natural wood roof. Fill the tube with bird seeds, put the cap on and hang the pipe from a tree. Check out our pvc bird stand selection for the very best in unique. PVC Pipe Bird FeederĬut a few openings in one end of the PVC pipe and line the inside with hardware cloth. Upcycle a stove pipe into this bird feeder DIY by attaching it to a copper pipe and a planter saucer. Look how you can use a fence post, PVC pipe, plastic disk, wood, and screws to make one of the most interesting DIY s quirrel-proof bird feeder ideas in this list. This DIY is an excellent idea to keep squirrels away from the bird feeder in your yard. How to Build a Telescoping PVC Birdfeeder PVC Bird Feeder Image 6. PVC Tube Bird Feeder How to Make a Bird Feeder out of PVC Pipe 5. Squirrel-Proof PVC Bird Feeder PVC Pipe Bird Feeder 4. How to Make a PVC Pipe Bird Feeder PVC Bird Feeder PVC Ball Bird Feeder 3. Even if they manage to do so, the bottle lowers down due to the weight of these rodents, covering the food entirely. Homemade PVC Bird Feeder PVC Bird Feeder Plan 2. This video is the second part of a two video series on fabricating a. The use of a plastic bottle in this bird feeder DIY makes it difficult for the squirrels to reach for the food. birdfeeder birds pvcpipeinstall Hello, and thank you for visiting my YouTube Channel. This bird feeder is not just squirrel proof but looks modern too. Get the step by step tutorial at Instructables. Ready a PVC pipe into a bird feeder using PVC Cap, glue, metal screws, cable ties, wood block, and drain pipe. We stock bird houses made from wood, natural fiber, metal and plastic in a range of designs that can blend in or stand out. Made to last these feeders and houses will stand the test of time. Feeders have a removable finial for easy quick refills. All houses and feeders have removable roofs for easy clean-out and durable bodies with proper drainage and ventilation. If squirrels are eating the portion of your feathered friends from feeders, try to introduce one of these DIY Squirrel Proof Bird Feeder Ideas. Copper roof Bird Houses and Feeders constructed with cellular pvc, which will not split, rot, or fade.
0 Comments
Read More
Back to Blog
Pro line for mac cosmetics12/8/2023 Learn how to create the latest trends or use the newest product launches on YouTube, where M♺♼ Artists, your favourite influencers and more show off easy ways to achieve any look. After all, it pays to be loyal.įrom face makeup to high-impact colour for eyes, to skincare and lipstick, there’s always something new to discover and play with. With every order and haul – big or small – members earn points toward future purchases, early access to new collections and collaborations, invites to exclusive in-store and virtual events, special seasonal offers and more. 19 Essential Makeup Tools and Innovative Gadgets for Your Beauty Arsenal. Estee Lauder and Clinique are also among the top 10 most valuable brands. Ottieni un accesso esclusivo online a, scopri in anteprima le nuove collezioni, esplora tutte le innovazioni artistiche e partecipa a eventi esclusivi, Pro-to-Pro e Master Classes. L’Oreal is especially popular in Europe and North America. Il programma M♺♼ Pro ti connette con una comunità che condivide le tue passioni per la make-up artistry. Want to really be in the know? Make your love official and become a M♺♼ Lover by joining our loyalty program. The number one most purchased makeup brand is L’Oreal Paris as of 2021. Want to be the first to hear about what’s new? Subscribe to our email newsletter to hear about upcoming launches, receive exclusive discounts and more. From free shipping with 35+ to complimentary samples, get the lowdown on all the exclusive offers happening online right now. In addition to debuting in-store and on, we debut new products and collections on Instagram, Twitter, Facebook and YouTube. To discover the best new makeup products from M♺♼, explore online by clicking here. High-quality products should provide good colour payoff, easy and precise application and comfortable, long-wearing benefits. Whether you’re looking to replace or update a go-to favourite product or switch styles entirely, look for products that enhance your natural tones and features. Apply the best money-saving MAC Cosmetics coupon to your cart plus get free standard shipping for. To find the best new makeup products, consider what best fits for your needs, style, skin type and specific features. July 2023 top coupon for MAC Cosmetics: Students & Teachers Get 30 Off with Mac Cosmetics Coupon.
Back to Blog
If you don’t have that particular type, a transistor cross-reference guide can sometimes help you to find a compatible, generic part. DISCRETE SEMICONDUCTORS DATA SHEET book, halfpage M3D088 PDTA144ET PNP resistor-equipped transistor 1999 Apr 15 Product specification Supersedes data of 1998 May 19 Philips Semiconductors Product PDTA144ET Transistor Equivalent Substitute – Cross-Reference Search. PMSE-T Datasheet PDF, Looking for PMSE-T Datasheet, PMSE-T PDF Datasheet, PMSE-T Equivalent, PMSE-T Schematic, PMSE-T Datasheets, Cross Reference, DATASHEETBANK, PDF Download,Free Search Site, Pinout Review Diodes’ datasheet to determine if the device is an exact drop-in replacement or similar device.Ī page which shows a specifications chart for various signal transistors. Diodes assumes that the information is accurate, but bears no liability due to incorrect or incomplete information or other errors. Discuss, 7,Ĭross Reference information is based upon Diodes’ marketing research. Chapter pages in book: p.TRANSISTOR C1741 datasheet, cross reference, circuit and application notes in pdf format.C1741 datasheet, cross reference, circuit and application notes in pdf format.Transistor cross reference equivalent book pdf
Back to Blog
A c battery pack12/8/2023 Up to 1800 watts of continuous power and 3600 watt peak. : BLUETTI Expansion Battery B230, 2048Wh LiFePO4 Battery Pack for Power Station AC180/AC200MAX/AC200P/EP500Pro, DC Power Source w/ 100W USB-C, Extra Battery. It makes sense for the next wave of compact cars to benefit from this technology, and we could see it first in the revamped CLA debuting in 2024. 0 0 add-to-cart Plug-in AC battery charger for Rechargeable Battery Tube The Plug-in AC wall battery charger is required for charging Ni-MH battery tube prior to installation. Harbor Freight portable power stations are ideal for camping, road trips, emergencies and more. If youre looking for a compact external battery pack for your iPhone (or any smartphone), Mophies pocketable Power Station Mini (2022) features a 5,000-mAh internal battery and 20-watt USB-C PD. 12 volts of DC power from the battery pack to household power, an AC power panel. Since AC is much better than DC for long-distance transmission, the power grid uses AC. For example, AC can travel long distances without losing much power whereas DC electricity cant travel so far but is much easier to store. The Omni 20+ is a portable laptop charger that is fast and reliable. The biggest difference between them is in the distances they can travel without suffering major power losses. Long battery life - prints at least 2000 2 in. The AC Adapter can be bought separately: Part Number M210-AC. If the Battery Pack is bought separately: Use AC adapter/charger unit (not included) to charge battery. 56 Plug-in AC battery charger for Rechargeable Battery Tube (9018620) 74.76 87.95 USD InStock /Products /Products/Power Accessories /Products/All Products /Deals /Products/Somfy Black Friday Deals Plug-in AC wall battery charger for the Rechargeable Battery Tube The XPower Powerpack 1500 system consists of a battery pack that stores. Smart & Portable AC/DC/USB-C/Wireless Laptop Battery Pack. The standard BMP21-PLUS and M210 does not come with a battery pack.
Back to Blog
Kingdom rush origins duskwood outpost12/8/2023 Most of the Night Watch and most of Darkshire’s NPCs are straight up dead, and in Terror by Torchlight it was confirmed that Sarah Ladimore is the new Commander of the Night Watch. Most notably is that Darkshire would look very very different. Okay in all seriousness, Duskwood is a zone that’s been through a lot since Cata that could use a few changes to reflect that. Tauren, Bilgewater Goblins, Druids of the Fang, and even the dreaded centaur tribes also aid in thwarting the Steamwheedle presence, but each side has their own agenda. Various criminal elements from Gadgetzan are in competition to control the tram and to profit from a hell on wheels built around the construction site, while the newly risen Botani quell the Goblin incursion at every turn. It’s a mad rush to push the tram’s construction through the Barrens from both Gadgetzan (finally and very happily styled in it’s proper Mean Streets incarnation) and Ratchet. Spanning the divide Deathwing created is a newfangled Goblin tramline, complete with a settlement/ station built over the gap itself. Northern and southern Barrens are reconnected. It wouldn’t be out of the question for them to push up and continue on to help out in Loch Modan. Gilnean druids to the south have already terraformed a fair portion of the land. The zone is chalk full of Scooby Doo, Stranger Things, and Gravity Falls references.īonus points if the Badlands become less, well, bad. A prominent side quest would include a group of naturalists attempting to investigate the aggressive behavior of a myth-like thresher maw in the Loch (C’mon folks, it’s obligatory) among other strangely behaving semi-cryptids. Folks looking to reclaim and develop the land task adventurers with finding the source and eliminating it. Even as the forest returns to a healthy seeming state, lingering corruption taints the minds of dreaming denizens and spits out the occasional nightmare creature. Old God corruption is out of sight but not out of mind. The dam is repaired and the Loch is now filled back in with the aid of nature spirits. Following the end of the faction war, Horde shaman and druids, as something of a good will gesture (and at the behest of their respective organizations) have made efforts to restore the region to a pre-Twilight spillover stage. If you had your way, what zones would you redesign and how? I think we’re all ready for a redesign of Azeroth and an end to faction war plots. Let us know if you succeed.I took a bit of inspiration from the Headcanon thread and faction dancing thread. Its long range can attack both corridors. If you have extra money build one Golden Longbows at the center. At the very last maybe you will need to upgrade the barracks to Bladesinger Hall. And the thunders when you see large groups at the right of the map. Try to use the frozen trees of the map as much as possible. The first thing is to take the Eldritch Doom ability on the Wild Magus. With the earned money upgrade the barracks to the Ranger Barracks stadium but not further. Then upgrade instantly both the Mystic Dais to the Wild Magus. In the first two central spots i placed two Defender Barracks, one for each corridor. I used Vez'nan because his demon can defeat the ghost troll, because he can absorbe one enemy and because he has teleportation.
Back to Blog
Snapgene align sequencing results12/8/2023 I hope these tips will help you get the most out of your DNA sequencing verification and to troubleshoot any problems that come up. Most chromatogram viewing programs (even the free ones) allow you to edit the sequence. Edit your DNA sequenceįinally, when you do see a miscalled peak, don’t be shy. The precipitation method has an unfortunate side effect of messing up the reaction around base 70-75 of the read (see image below), so I would strongly recommend using a silica spin column. If your sequencing facility requires you to perform your own Big Dye PCR amplification reaction (as opposed to using the all inclusive service some companies offer), you can purify the product either via the Sodium Acetate/isopropanol precipitation method or using a silica spin column available from several vendors. Use a silica spin column for purification of the samples you send for DNA sequencing The peaks here are usually unresolved and small, so I suggest designing your primer at least 50bp upstream of the sequence of interest. Never trust the first 20-30 bases of a DNA sequencing read Anything more and you’re venturing into the uncertain terrain. Watch this Getting Started video to learn how to analyze your sequences and verify your results using the tools menu. Expect to get 500-700 bases of clean reliable DNA sequence.Īnything less and you might suspect contamination in your sample or consider asking your sequencing facility to apply a special protocol for a difficult template. 1 minute 30 secs Get Started: Use Tools to Analyze and Verify INSIDE THE VIDEO SnapGene offers many tools for checking the accuracy of your clone. You should see individual, sharp and evenly spaced peaksģ. Addgene NGS Result TTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCG Aligning to a Reference DNA Sequence Align DNA. You can use any of the following programs to view your. Here are a few guidelines to help with DNA sequencing troubleshooting and analysis 1. In fact this is so ambiguous that the DNA sequencing reaction should be repeated. If you never looked at the trace you would be happy.īut look closer, the overlapping peaks in the chromatogram suggest the results are not as certain as the sequence may suggest. Here is an example of a seemingly clean DNA sequence (no Ns in sight). An example of where the chromatogram can come to your rescue for DNA sequencing troubleshooting and analysis And, like all controls, missing out is a big mistake. When it comes to DNA sequencing the chromatogram is your visual control. These controls help you properly visualize your results. When you run a restriction digest on a gel you always include proper controls like uncut DNA and the proper ladder. The most important of those is to always look closely at the trace file (or chromatogram) of the sequencing results you get back from your favorite sequencing facility. So I have developed some good habits that I wanted to pass on to you to make sure you are getting the most out of the data you get back from your sequencing runs. Please make your choice based on your computer platform and operating system.As part of my job ensuring plasmid quality at Addgene, I analyze 50-100 sequencing reactions a week. You will find information about downloading, installing and using the software. Click on the appropriate icon(s) to go to the respective Web page. Tools for Viewing Sanger Sequencing Data Sequence / Chromatogram Viewing SoftwareĪ number of free software programs are available for viewing trace or chromatogram files. Azenta Life Sciences Consumables & Instruments.Gene Synthesis & Cloning/Mutagenesis FAQs.CLIA Variant Confirmation (PCR + Sanger).
Back to Blog
Screen share12/8/2023 If you do, the best tool for the job is typically a dedicated screen sharing app, a video conference app, or a team chat app-so that's where I focused my testing this year. So unless you have a specific, niche use case, you might not need a dedicated app for screen sharing. In other words: you probably already have screen sharing features built into one of the other tools you use. Sales enablement platforms like ClearSlide and Demodesk let you share demos, presentations, and more with prospects. Video-first customer engagement platforms (like 24sessions) often include features for co-browsing your website or app. Webinar software lets you share your screen with large audiences. Live chat apps make customer service more seamless by sharing the customer's screen. Help desk and customer support tools often offer co-browsing, remote access, and more. Wireframe tools help you brainstorm and collaborate together with screen sharing.Įmployee onboarding software helps you co-browse and screen share to walk new hires through onboarding. Mind mapping software helps you brainstorm together with screen sharing.įlowchart and diagram software sometimes lets you screen share to design together or get feedback from colleagues. Whiteboard tools usually offer screen sharing for virtual collaboration. Video conferencing and team chat tools have supported screen sharing for a while now-but today, tons of other apps offer it, too. Surfly for co-browsing your app with leads and customersĬoScreen for hands-on remote collaborationĭo you actually need a dedicated screen sharing app?īefore we dig into the top picks, it's worth asking yourself: do you actually need a dedicated screen sharing app? As I've updated this article over the last few years, I've noticed more and more apps adding screen sharing as a side feature. Slack for collaborative internal meetings Below, I'll share the top five: the best screen sharing software for a variety of use cases. To help you avoid the annoying, I looked at dozens of apps designed for screen sharing-extensively testing more than 40 of them-to find the best of the best. I've seen the good, the bad, and the very annoying of screen sharing apps. I've worked remotely for eight years and have used all sorts of screen sharing tools in that time to collaborate with team members and clients. That's why choosing the best screen sharing software matters.
Back to Blog
2 feet wide bookcase12/8/2023 Handcrafted Amish Furniture Made in the Heartland of America. Our bookcases and room dividers are available in three core categories including BASIC, PLUS and GOLD. These categories represent three levels of quality and price from great value for money to superior quality at affordable prices. Interested in Amish Bookcases Furniture Look no further, get in touch with us today by email at or dial us on 1-88. If you love to read and have an extensive collection of books then store them proudly on a bookshelf where you can admire and access them easily and pick up where you left off.Ĭreate variety and optimal use of your bookcase or room divider by putting boxes or baskets in some of the rooms. It is a smart solution to avoid clutter in the home and toy chaos in the children's room because things are easy to clear away. If you do not want your things to be visible, you can advantageously choose a bookcase with cabinets and drawers. How much would an order of 1 slice of cheese pizza and 3 sodas cost A. Choose trends and convenience with our ladder bookcases available in white. Jordan bought 2 slices of cheese pizza and 4 sodas for 8.50. Bookcases and room dividers are the ideal solution to partitioning off areas to create 'two' rooms in one. With wooden, bamboo, metal and concrete look you won't have to compromise on style for your storage! Choose from bookcases and room dividers that are perfect for the living room, bedroom and dining area. Martin Furniture Avondale 8 Tall Bookcase Wall with Ladder, Storage Organizer, Display Shelf for Office, Brown 1 3,17202 FREE delivery Usually ships within 2 to 3 days. Our extensive range of bookcases available in a variety of colours, sizes and materials offers something for everyone. CREATE NEW STORAGE OPTIONS WITH A NEW BOOKCASEīookcases and room dividers are great for storage in all rooms.
Back to Blog
Light grey suit blue shirt12/8/2023 In addition, you can even mix things up by wearing this dress shirt with a blue suit! You can also match a light blue dress shirt with a black suit this will tone down the suit’s formality and soften its harshness. You can pair a light blue dress shirt with any shade of grey suit you may own.Ī charcoal grey is very professional, and wearing a light blue dress shirt with a light grey suit is a very laid-back style. It can go with most suit colors, even though it is slightly less formal and less versatile than a white dress shirt.Īlso, a light blue dress shirt looks flattering on nearly every type of skin color so that everybody can wear it. Light Blue Dress ShirtĪ light blue dress shirt is the second most important dress shirt color a man should own. The bow tie allows you to show off the features of your dress shirt better than a necktie would. If it’s a broadcloth or twill weave white shirt, you can even wear it with a tuxedo and a bow tie. It is also pretty easy to dress this shirt up, using a few style choices.įrench cuffs or double cuffs will raise the shirt’s formality, as will a French placket. They’re so subtle that it’s only noticeable up close the shirt looks like a traditional white button-up from afar.Įven though the patterning is incredibly subtle, it can make the dress shirt slightly less dressy if it’s too prominent.Ī fine weave is better, as it is less noticeable. The weave is usually a waffle pattern, although herringbone shirts are also popular. Weave White Dress ShirtĪ weave white dress shirt is very similar to a plain white dress shirt, except it has a nearly unnoticeable patterning. It would be best if you also avoided a dress shirt with a pocket on it.Ī pocket automatically lowers the formality of any dress shirt, so skip the pocket to be able to dress up your shirt if needed.īecause you’ll have use for this dress shirt all year round, opt for medium-weight cotton fabric. Your shirt will be more versatile with barrel cuffs wait until you own a couple of white dress shirts before investing in one with French cuffs. To ensure that your white dress shirt is fully universal, don’t go directly for French cuffs. It looks sophisticated, trendy, and conservative at the same time. My favorite match-up for a white dress shirt is definitely a navy suit. You can wear them for your most formal business outings, but they are also capable of a more casual style. Heck, I’d suggest owning at least two or three of them. White dress shirts should be a staple in every man’s wardrobe, whether you wear a suit every day or only rarely. Moreover, it goes with absolutely every men’s suit there’s nothing this dress shirt doesn’t pair well with. It’s the standard against which all other dress shirts are measured it’s the most formal and flexible. There’s no arguing that the plain white dress shirt is iconic for men.
Back to Blog
Harry potter monopoly board12/8/2023 The rent you pay on the shrieking Shack with 1 Cottage is 30 Wizarding dollars, and that doubles if you have two cottages, and then triples if you have three cottages, and so forth. It has corresponding cards to the different sections of a traditional Monopoly board with the same rules. Out of all the homemade versions or unofficial versions, this one is pretty great. If you are really set on playing Monopoly, there are unofficial Harry Potter Monopoly boards available on sites like Etsy. I picked games that were fun, challenging, suitable for a large family or just a couple, and of course, well made. The items included in this best Harry Potter Monopoly guide are all subject to the same criteria. It will cost you less than $10 in a few hours of your time to put together, but then you will have a game that no one else has. I recommend investing in the unofficial version. Still, this best Harry Potter monopoly guide will help you choose from many other Harry Potter games, including some fan-made-Monopoly editions (unofficial). However, there is absolutely no official Harry Potter Monopoly game because no agreement exists between Hasbro (the company that makes Monopoly games) and Warner Brothers (the company that made the movies). With my years of experience (no longer tossing the board), I have come to appreciate many models and iterations of a classic family game. So now I know that even if my demise is imminent in a game of Harry Potter Monopoly, no matter how cute I look doing it, flinging the board up and off the table won’t get me the canned laughter it does on TV. I hoped they would land on the lesser of two evils. Instead, the room became uncomfortably still as faces told me our three friends were waffling between judgment and indifference. Turns out, it isn’t funny in real life–especially when people don’t know you are joking. I threw my hands up in frustration, made some sarcastic comments, and wiped all the pieces off the board. I knew it was my chance to replicate the always hilarious sitcom scene. I-have-an-impressive-stock-portfolio was about to leave everyone else in ruin. Monopoly is supposed to be a fun game where you watch a close family member take all your money and leave you crying in a pool of your own failure.Īt one point, it was clear that Mr. It is treated like a legitimate business deal and investment opportunity. My better half takes Monopoly very seriously. One evening we had a casual dinner party at our house with three friends of ours. I had grown up seeing people in movies, and television shows get agitated during a Monopoly game (or other game) and wipe the table clean in a hilarious tantrum. Hogwarts Classes Schedule Explained - August 11, 2023.Harry Potter Chocolate Frog Cards Guide - August 11, 2023. |